Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D106A10
Clone ID D106A10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD106A10
Sequence
GACACCTCAACGCCCCGAACTCCGCCTGTTTTGTTTGGAAAAAGCCAAGAAACCGCCCAAGTCTCCACCAAATTACCCGT
GGATGAAGTGTCATGTAGCTTATCAGAATGTGGTTTTACAGTAACAATGAACGTTGTAGAAATAAATGGCAAGTGGCAAC
CTGTTGACAGCGATACATGTCAAGTAGTATCATCCAGTGGATTTGGGTTGCTGATGGTAGGAATTTGATTTGCCATCTTG
AGATGCTTGCGTGTACCTTATT
Sequence Type genomic DNA
Unitrap ID UNI11042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18288632..18288892 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]


SPLK-Sequence tag 3SD106A10
Sequence
GTATGCCAATCACTATTAGGGTGCCCNNNTCTCTGCTGGCTCAAACTAGACTCCCAGCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es