Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D105E11
Clone ID D105E11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD105E11
Sequence
TTGATTGTCAGCCTCCCCACAGCAAGCACCTGGGATTTGTACTCATTTTCCAAG
Sequence Type genomic DNA
Unitrap ID UNI30137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138037902..138037955 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]


SPLK-Sequence tag 3SD105E11
Sequence
CAAGTTGATTAAAATACATTTTAAAAATCAAAATGAGAAACGTAGGATGCTTATCGCAAACTTCTTACTTTTTCTTTTTC
TAATGGTGTGTGTGTGCGCGCGTGTCTGCATACAC
Sequence Type genomic DNA
Unitrap ID UNI30137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138037791..138037905 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es