Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D105B01
Clone ID D105B01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD105B01
Sequence
TCAACAGGGCTGTGGAAGAATAATGATGAAGTTGATGATTTTGGGACCTGAACTGCAAAGTGAAAGTGAATGGAGTTGGC
CAAGAAAGATGGGTCCAACTTTCCATTTGCGATTTTTTTTGCCATGGACAGATATGTTGCAAGCATTCTCAATCTTGTTG
CCTGTGTAATTTGAAAATATATTAAACGATAACAAAGTCATTAGGTTTTATAGAATACCGAGGAATGCACGATTGAGTGA
TGAGGTGAGGAATAATGCAATTCTGGTGCAGAAATTTCATAATATGGAGTCCACCTAAAGACCATCCAGTGGATGGAATA
GTTGCATAATTCCAAGGATTTTAGACATCAGAATTTTGATAAATTCAAATCTAAAAAGATTTGAATGTCAATTCAGTGTA
GCACGTTCAAGACTTAAAGTGAGGTGTTAGTCATTTTTAATGATTCATTGCCTCACTAAATTTAATCATTTTGCCTGGAG
AAGAAATGGGGGAGGATGGAGGGCTAGAGTCCTAAGAGAGATAACTGGGTT
Sequence Type genomic DNA
Unitrap ID UNI30139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154441757..154442287 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059842 (Zfp341) NM_199304 zinc finger protein 341 Gene [Source:MGI (curated);Acc:Zfp341-001]

 
Come back to gene ENSMUSG00000059842


For any suggestions or comments, please send an email to unitrap@crg.es