Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D105A07
Clone ID D105A07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD105A07
Sequence
AGTCTAGCAAAGATTTGGGGAAATGTCTGCAAAGTGTATTTGAGTTAGGTCATATGTGTTTCATGCAGTGCCATGCGGTT
AGTGTGCCTCCTGTTCCTAATAAGGGGCAGGCTGGCCTGTTTTAAATGAGGTGTCTGTGGTATGGAACTGAAGGGATTGT
TTCCGCACTGAGGGAGACCACCTCGTGTCCTGACATTTAAACATGACCTCAGCCTTAGAGATGCCTATGAATTTTAAATT
TATCTTATGTTGACATCTAGGTTTTTCATGTTTTTTTCTGAGGATACTACAGTTTAGGCTGCCTCAAGCTGGCTGCCTTT
ATAGATGGGTAAAGCTGCTCCTCGCTCACCTCAGCATCCTAAGCCCTGAACTGTGGGCGCACACCACTAAGCCTCTCTTT
TAAAATATTGGCCAGGGGTTGGTTGTTCAGTGTTCTGTTTGCTTT
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312271..114312715 445
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 3SD105A07
Sequence
CTCGGGGTTAGTTTGTTGTAAGGAGACAGAGTTGGGGGAGGAAGGGATGCTGAAAGTTGTGGAAAAAGCAGAGCACCGGA
GCTTAGGAAGTATGCCGAGTCCTCAGTAAGCAGACAGGCAAACAACCCACCATTGAGACACATAGGTCTTCTGTTGTACC
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114311901..114312060 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es