Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D103E04
Clone ID D103E04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD103E04
Sequence
AAACCGAAGCTAGCCTGTCCAATACCTCAGCTGCAGAGTCAGCTCCGCCTGGGGATGTTGAAGGGCCTGGGGAGGAAGAG
GAGGGCCCACATGCAGCAGGCACCCTTCCTCCAGGAGGGATTGAAGGGCCAGAAGAAGAGAGGCCACAGTTCAGTTCTGG
GAAGGAGCCAGGGCAGGAGGAGGCTGGGGTGGGGGTTCCCACAGAGGGGGCTGCCAGTATGGAGGCAGAAGTGCAAGAGG
GAAGTAGTGGGGTCCCTGAGGAATTACAGGGACTCTTAGGAGATGGGCCTATGAATGAAGCAGCAGGGACAGCAGAGTCT
GTAGTCACCCAGTCCTCTCCTCCCATAGAGG
Sequence Type genomic DNA
Unitrap ID UNI30146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4497140..4497490 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022519 (Srl) NM_175347 sarcalumenin Gene [Source:MGI (curated);Acc:Srl-001]


SPLK-Sequence tag 3SD103E04
Sequence
AGAGGGTAAAGAGGCAGAAGGTGAGGCCCATATAGGTTCTGATCACCAATCCACAGAGCTAGATGGAACCCAGGATGCCA
TACCTGCCGGAGATGAATCGGAAGCCAGGGAGGGAGCAGAGGACAAGCCCCAGGACTACTCCCTGCAGTCAGAGGACACA
GCCACTCCCGGGCCTGATCACCAGCCCACAGACCTACATGCAGCCTCTGACACGGCATCTTCTGGAGTAGAGGCAGAAGA
AGGTGCAGAGGAATCAAAGGCTGAGGTGGACACAGAATCTGGGGAGAAGGTTGAGGACCAGGGGGAGCCTAGACCTAGCC
TGGATGCTGGTTCAGCTATAGAGGCCAATAAACAGTCTG
Sequence Type genomic DNA
Unitrap ID UNI30146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4496786..4497144 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022519 (Srl) NM_175347 sarcalumenin Gene [Source:MGI (curated);Acc:Srl-001]

 
Come back to gene ENSMUSG00000022519


For any suggestions or comments, please send an email to unitrap@crg.es