Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D103C05
Clone ID D103C05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD103C05
Sequence
GCAGTTGATGCGAACGTGACATGGTGGCAAGTCGTACAGAGCGTGGGGGGCTTAGGTTGTTTGNNTTCTGGTGCTCAGAG
GTGTTTGCTGAACATTGTCACTGGAGTCAGCGCCCAGAGGGATCTAAGCGATCAGCTTACCACCTTCCCACGGGCGCTTA
CTGAGTGTTTATAGAAAAAGAGGCCCTGTTTGTAAAAGGTCCCAGGATACCGTAGTGTTTTGGTCTCTGTTTTCAACCCT
TTCTGGTGGAGGTATACTGACAACTCCAAACAGTTGAGAGGGTTAGGCTTGTGCAACCTTCGGAAGAGTTTTCCTTTGAG
TCAAGCCAGGCCTCCATGACAGGAATCGTCTGTGCCAAATTATTGAGAGGAATGTCTCAAGCAATCTGCACAAGAAGCGT
AGAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD103C05
Sequence
CAGATCGGAAAGACTTCTGAGTGGTTGAATGTTATA
Sequence Type genomic DNA
Unitrap ID UNI30147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110607033..110607068 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]

 
Come back to gene ENSMUSG00000029502


For any suggestions or comments, please send an email to unitrap@crg.es