Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D102H09
Clone ID D102H09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD102H09
Sequence
GATCTTTCTCCCAGGGCCACCATAAAATTAATGGCTCTCCCTTTTACTTATAACTGGTTCATACCAGTTGACTACACCTA
AGCTGAAGTGCCTTGAAGTCAGATTTTAGTGCTTGGAGTATTTCTTAATATGTACAGTAAGATATCATAGAG
Sequence Type genomic DNA
Unitrap ID UNI29633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59588264..59588415 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


SPLK-Sequence tag 3SD102H09
Sequence
AGAGGTGGGACCCAAGTCTAAGCACANNATTAATTTATGGTTTATATACCCTAAAGACATGGCCTGGAGTTAACTTTAGA
CAGTATTTCAGTGTGCTTGTGCTCTGACGGTGGCTTGTGACGTGAAAGCAGGTAGGACATTTACCACTTGTATATCAGGT
CTCTGCTCAAGACCCAGGTTTGAGAGATATTCTTATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es