Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D102H05
Clone ID D102H05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD102H05
Sequence
TTAATTCTCAGTTTTCTTTTTTAAAGTTTTTTCCCTCCCTAAAT
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91593019..91593062 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]


SPLK-Sequence tag 3SD102H05
Sequence
ATCACAACTTGGCTAAAGCTTTTTCTTCTTTGATCTCAGCCTGGCCTTGAACTCTATTCCAGATTACTTTTCCTTTTTGT
GTGCTGAGATTACAGACTCCATAATTGGCGGGCATAGAACAGCTCAGTGGCAGATTCTGGGATTTTTAAATAATCATAGG
ATGAGATAGGGACAGTAAGGGACTGTTGGTGTCTATCATTGAAGAGAACCTTTCACAGGCAGAAAAAATGAGGTTAGTTG
TAGAGAATTTTTTGAATCCAGGTGGTGCTGAGGGGCCATCAGACACGTGTCTTATCATATTGATGACAGGGATGCAGGGA
TGGGATAAAGATTTACATTGTTGTCTTAGATGTATTTATGCCATTTGTGCTTGACGAAAAG
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91593343..91593723 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es