Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D102G07
Clone ID D102G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD102G07
Sequence
TCAGTACAATGTTGAATCAGCTTAGGGACACCTTCCCCGACTGCTAACTCAGACATTTGTGACAGGACACGTGAGACTGA
CCAGGTGTGCATGAGTACAGTACAGGGCTTGTGATGGGACGACCGCCTTCATACCTGTCTTCATAGCCTAGAGTAAAGGG
CGTTACGGACTGGCTGCCGAACATTCTGATGATACCAGCATCACTTCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD102G07
Sequence
AGAGAGATGCTCTGTGGTTCAGTTTCGTCTTAGTATTTTCCTAGTTTTAATGTGATTTGTTGGGATTGGCTTGTTTCTTA
CTGGACAATTTGTGCTCCCTTCAGTGACCTTAGCAGCTCTGACCGTGCCCAGCATGGTGTACTCTTTGAGTGTGTCAGAG
GAGGCCCTTCTCATGGGAATAGAGTTCACAAGATTAAGATTCTTCTGGGTATTTTGTATATTATATGCATTTTAATAGCA
GGAAAGTTGATTAGTTTTTCTCATGAGAAGCACGTGGCTCAGGTTCACACAGTATTGAAAGTGATCAGTAACCCGGAGTG
GAGTGAACTCGTCATGGGGAACTTGAGCCTATTGTGAG
Sequence Type genomic DNA
Unitrap ID UNI10639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56879373..56879730 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]

 
Come back to gene ENSMUSG00000024590


For any suggestions or comments, please send an email to unitrap@crg.es