Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D102F03
Clone ID D102F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD102F03
Sequence
GGATCCTGGACGTTTTGTGTTGCAGTGGCAGAGGAAGGTGTCTGTCCCCTAGTGGGTTGGGTGTCAGGTGTGCCCTACCT
GGAAACTGCACGGTAAACATGAGGCTGCAGCCTTGAGATTTGGCAAATAACTTTTTTCATGTTTTCTGGTGTGGCTTCCT
TTTCCATCTCTACTTCCATCTGCCTCTTGGGAAATTGCA
Sequence Type genomic DNA
Unitrap ID UNI13159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22417921..22418119 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 3SD102F03
Sequence
CCAGAGTCTGTTTTCTCTCTGATCACCTCTGAGACTCTAATAGGATGCTTAAGAACTGCTTGGTTAGAAGTCCTGGAAAC
TTACTAGCTGAGAGACTGTAGCAGGCTCCACGAGCTTTTTTCCTATCTAAATGGAACGAGTGCAAATAACATTTTCCATT
GGAAAGACTGAAGGAAATGAAATGAGTGCAGGCATCTATTTACCACAGAGGAGGACGAAGAGCCTGCCTGGTTGTCTCTT
TCTTGATCTGTCTCCTTTATTCTTTTCCAGAATTACTGTTTCCTCCTGTCTCTTTTCCTTTGTTCAAGAGTACATTTGA
Sequence Type genomic DNA
Unitrap ID UNI13159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22417351..22417669 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es