Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D101E06
Clone ID D101E06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD101E06
Sequence
GTGGGATCCTGCTTTTCCCCGACTTACCGAGTTTATGAGAGTTCAGGGACCTTCGGCCTCATTGTATGGATGGACTCTTC
CCCCCTTGCACCTGGAAGATCATTGGTTGTTCTCAGGTCCGGAGGGGAGTTTTTGGGTTTTGGAGCATCCCACATCATAG
TTCCGGGCAGCTGGGATGGACTCTTTGTGCCTTGGCCCGGGGAGCTAGGGGTGGGGGTGCAGATCATGGAGAGGCTGGGT
CGCTTGGTCCACCTGGAACAAAAANNGTTAACCCTCANNCCCGCCTGCTTNNNCTGGAGAGGAGNNNGCGAGCTCTCGGC
CCTGACCCCTCCCCTGGTCCTGCGATGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD101E06
Sequence
CATTTGGGGTGAGCGCATACTAGTGTTTTTTGTTTTGTTTTTTTCTCCTATTTAGCTGGTGGTGGGGACTCTGGGGGTGG
GCGGCATGGAGAGGTGGCTTGCTATAGAAGGGCTTCCGAAATCTCCGCTGGCTGGAGTCGTAGTTAACCTGGCTGCACCC
TGAGGCCGCTGGCGCGCGCTGCCACCCAGCCTTGGGAAGCGAGTTTTCTGCGGATCACTCGCGGTCGGAGCCCGGCCTCT
NNCGTGCGGGCGCCCTCTGGAGACCGGCCATGTGCGGACTGCGACACACACCTGGTGAGTGAGGTTAGCTAGGCCGGAGA
CCCGCACACGCGTGATCTCTGTGGGGTCCCCATCTTCTGCATCAACATCAGTGTTTGGGAATCTTCTCCAAGAGTTCTTA
AAATGTGTTTGTAGGGGGACCTCGATTGTGGTTTTGGGAAGAGGTTTTTTGTTTTTGTTTTAAAATTTCTTTAATGCCTG
CATTTTGGGATCACCCTTAGTTTAGATAAATCTTTTGGAAGCTTTTGG
Sequence Type genomic DNA
Unitrap ID UNI30150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168590360..168590888 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es