Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D050H09
Clone ID D050H09
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D050H09
Sequence
CGTCCCCTCAGAGGAGAGGAAGATCCGTGTTCTTGTGGGCGTCACTGGCAGCGTGGCCGCTCTGAAGCTGCCTCTCCTGG
TATCTAAGCTGTTGGACGTTCCTG
Sequence Type mRNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57282712..57282815 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]


SPLK-Sequence tag 3SD050H09
Sequence
CATGNNNTGATCCAGGACCCCCCCAACCCTNNGCACTCAGGACCTTTTTGCTAAGTGAATGAAGGTGAAAGAACAAACCC
GACANNCTGGATGAGTCAGATCAAATGGCATCTCTTTAAAACCAGAGAAACTAGCCTGGGCTNGCCTGTTAGCACTGGGG
GTGGGGAAGGGCATAGGGAAGCCCCTGCCTATCAGATATACGCCACATTACTACTTAGGGGAATACATTCCCCCCNNGNN
GGTCCCTAGCAGCGAGGCTGTACACCATGGGAGGGTAGCCAGAGTGTGGACTGGCTAAGAAGTAGTGCAAAAATCTTGAA
GGAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es