Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D101C07
Clone ID D101C07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD101C07
Sequence
ATCCCCATTACAGATGGTCATGAGCTTCCATGTGGGTTCTTAGAATTGAACTCATGACCTCTGGAAGAGCAATCAGTGCT
CTTAACCAGCCATCTCTCCAGCCCAGGTGCTGGCATCTTTATTGAGTTGTCACTATGTCAATTGAGGACAAGGCCCTTCA
TGGTATGCTCAGATATAGAATCAAAGCACTAGAAGCTAAAGACTGCGTGAGGGTATCATAGCAAGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD101C07
Sequence
CATTCTGTAATNNNATTTTACAAATATGTAATTTCCTTTCCTTAAACTTTTACTTTGAAAATCATATGGAAAAACAAAAG
AATGTTCAATACTCAATATATTTTACCTTGTTTTTATATTTTGTCAGATTTGTTTTATGTGAATTCTTTGCTTAATCACG
TAAAAGGAAGTTACAGGTAGTGAGATATATCACTTGTAAATACTTTTCTTATTTTAATGCTAAGCATAAAGATATTTACG
GTATGTTTTGTACTTTTGTTGTTTTAAAT
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21157157..21157425 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es