Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D100F12
Clone ID D100F12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD100F12
Sequence
TTACTTAATCCCTGATTCATTCCTTCAAAGCACAAATAAAGGTCTTGTATCCCTCCTTCCCGAATTTGGAAGTATTTCCT
AATTATATGTTGTGTATATCTTGGAATGTTGGTACAGTGATGGCAGCTTCATAGCACGTGCATT
Sequence Type genomic DNA
Unitrap ID UNI26976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57421844..57421987 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]

 
Come back to gene ENSMUSG00000031139


For any suggestions or comments, please send an email to unitrap@crg.es