Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D100C07
Clone ID D100C07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD100C07
Sequence
CAGTTCAGTCACCACGTGCCTGTCTCTTTGTCNAGNNGTTCCCTGGGTTTTTGATTGTTTCCCAGGGNNGNNAGCCCTGG
GCAGTGTCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD100C07
Sequence
CACAGAGGATAGACAGTCAGGCCTTTGTATCCATGAGCC
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25700206..25700244 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es