Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D099H08
Clone ID D099H08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD099H08
Sequence
AGGATTTTTTGAATACTACAAAATTCCACTGCATATGTATTACAGACCCCTGGTTTGAGATCACCCTTCAAGACCCTATT
CATACTGAACACACAAGCCCACATTAGAAAAGACAAACCAGCTAGTGGCCACCATTAGCCTCTTCTGAATTGAGCCCGTC
TGGCCCCGCCCAGGACCGCAGAGGTTTCTAAGGACCCGCCCACCGGTGCTAGTTTCCCAAAAACCCGTGCGGCAGACTCC
AGCCGCTCCAAGATGGCGACTCCCATGCATCGGCTCATAGCTCGAAGGAAAGCGTAAGTGAGATGCTTG
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53137951..53138259 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es