Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D099H06
Clone ID D099H06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD099H06
Sequence
GGATCCAAACTAGCTTGGTGACCAGGCTCTGTGATGAGAGGAGACTGTCACTAGGCTCTAGGGGTCCTGATAAGGAAACT
AGCCAC
Sequence Type genomic DNA
Unitrap ID UNI21857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124703483..124703568 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004263 (Atn1) NP_031907 atrophin 1 Gene [Source:MGI (curated);Acc:Atn1-001]


SPLK-Sequence tag 3SD099H06
Sequence
AATGCATACTCTGTTAAAAACCAATCCACAAACTATCTAGAAAGTGTAATTGTAGCTATAGTTGAAGTACACTAGTTTGC
AGGGCAAAGCATCAGTTGAAAGTTTGGACTTGGGGCTCTGTCCCATCCATTTTGTGCCCCCTTAGGAATAAGTAGTTAAG
TTTCCTGGAAAGGTTAGACTCACTGGTTCCTCATTGCCTGCCTCAGTATGGCCCAGGGGTGATGGACAAAGAGTAATCAC
CTTGTGTTCCTTAGAGAAAGTACATGTAAAAATGTCATTAACCTGTACCTGCCAATTCAGAATGAGTGGGTAAACTGAGT
CTGTTCTTTCCAAGGTTCCCAGCTAATTAAAAAAACCTGCTTAGCCCAGGGTATGCCAGTAATTTCAGCACTTGAGACCC
TGTCTCAAAAACACAAAACAATAACAACCAAAAAG
Sequence Type genomic DNA
Unitrap ID UNI21857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124702824..124703258 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004263 (Atn1) NP_031907 atrophin 1 Gene [Source:MGI (curated);Acc:Atn1-001]

 
Come back to gene ENSMUSG00000004263


For any suggestions or comments, please send an email to unitrap@crg.es