Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D099G02
Clone ID D099G02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD099G02
Sequence
AATCTGAAGGAGAGCACAGGTTAGCTAATCTTGATACAGAGCAGTCCATCGCCTTGTTGAGTGTGTGGGAAGAAGCAGCT
GTGGTTGATACTTTATGCACCCAGGGGAGGACCTTGACATCCCATGGGACTGAGGCTATGCTCATGTCATGAATGCTCAT
CCAAGTCTGGGTTTACTTGCTCCCCACACTCTTAGCAATGATTTCTCCTTAATAGCAGATTATTCCCCTACAAAGATGTT
AAATACTCTTTCAGATGCTTCTCTTACCTACACATTCTTGGTCCCACACCATCTGAGCTCTGTCAAGAGTTGTCTG
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115485319..115485634 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]


SPLK-Sequence tag 3SD099G02
Sequence
AACCCACTGTACCGAAACAGTGACCACTGTGCTGTANNCAGAATTGGTCTGTGTATTGATGTATTTGTTCATAGTTGGCT
GTTTTTCTTTAAGAAGCTTGTT
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115485663..115485764 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es