Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D099C01
Clone ID D099C01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD099C01
Sequence
AACCAGGGATTTCTAAAATACATGGAGACTTGAGCTGAGTTTACGTAGAAGAGGGATTAAGGG
Sequence Type genomic DNA
Unitrap ID UNI12693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127983034..127983096 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039810 (Zc3h10) NM_134003 zinc finger CCCH type containing 10 Gene [Source:MGI (curated);Acc:Zc3h10-001]

 
Come back to gene ENSMUSG00000039810


For any suggestions or comments, please send an email to unitrap@crg.es