Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D099A12
Clone ID D099A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD099A12
Sequence
GATCTGGAAGGCATGTTTTTCCATTGATCGGGTAAAGTGAACTCACCCAGTGTACGTGAAGGTAAAATAGAAGGTAATGA
TATTTGTAAAGAAATAATACGATTGCCATGAGCATCCTTATTGTTCCCTTCCTGTCTTTGTCTCAGTTGCTGATGGTGAT
GGCTAAAACCACCAAGTT
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93271286..93271463 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]


SPLK-Sequence tag 3SD099A12
Sequence
ATAAAGTTTGTGGTTTTGAGAGTCTAGAGAAGGGCCATTAGCCACCAAAGCTACTGGGGAAGGCCGGAGTGATCTTATCT
CTCTAAGCAAAACGACTTCCAGTAGCTTCCTGC
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93271533..93271645 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es