Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D098C04
Clone ID D098C04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD098C04
Sequence
GGATCCGCATCCCTGCTTGCTTGACATTCTCTCGATTTTCTAAACATTTTTGTGCAACGCTCAAAGGACCTTCCGTGCGT
GGGCGTTTTTCCTCTGCAGAGATGCTCAGGTGGGTGCATTTGCTGAGCTTGCTTTTCCTTTATTTGGAAGATAATCCCCT
AAGTGAGATCCAAGTCTTGCTTTGTGCAGTGACCCCGATGACCTCGCCTTTTCCTTTGTACTACAGGTCTGGCAGGACTT
TATGTTTTCCAGTGC
Sequence Type genomic DNA
Unitrap ID UNI30157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135210288..135210542 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es