Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D098B03
Clone ID D098B03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD098B03
Sequence
AAGACGGGNNCTTTGTGAAGCTTACTGATGCGCCAGCTTCTGAATTAATGTGGACAGTGTAAATGGCAGAGCAGCAGAAG
GTCTCCTTTATGGTTAGGAACGGCCTTGGGCCGTGGAGCTTCCAGCAGAGTGCTTGTGTATGATGTGCAANNCCCTGGGC
CCTCCCTAGTTAACAGCCCACATTATCCAGTAAGGATGAAGCTCACGATGAAACTAG
Sequence Type genomic DNA
Unitrap ID UNI30158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29124366..29124582 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es