Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D097G02
Clone ID D097G02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD097G02
Sequence
ACAGGCAACCCTGAGTGGTCCCAAGTCCCGGAATCGGAAAGTTTTTAATGTCATGTCCAGAGCAAGCTTGTCTTTCTTTG
TTCCTCTCCCCTGTAATCCACATACTCACTTAGTCAAGTTCATATTTTAGAATATAGATATGACAAGCAGTATTTGAAGG
GTACAAAATAGAATTTTTCAAATGAAAGCTTTTCTTTTTAAGGACATAAATACAGCACGTAGCTGTAGAATACTGAAAGT
GCTCATTTTAGTTTCTTCTAGTATGCTTCCACTGACTGAGGAGAACAAGCACGTGGCACAGCTGTTGTTCAGTTCTGGCA
CCTGTCCAAGATGCATCTTAAGATTCTGTGG
Sequence Type genomic DNA
Unitrap ID UNI30160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23567027..23567377 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es