Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D097F09
Clone ID D097F09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD097F09
Sequence
TCAAGCATACCATCTTCAATCTCACCCTCCACAAACTTTGTACAACCTACTCTAGCCATTTATATGTTAGGGCTCTGGTT
TTTGTTTTTTGTTTTTTTTTAATAGTTTCTATTTGGAAAATTCCAGGCATTTTATTTCTTACTATATAAAATCCTTTTTA
TCTAAAACATATTCATTCTCACCCCACCCCTTTTCA
Sequence Type genomic DNA
Unitrap ID UNI10335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36088367..36088562 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]


SPLK-Sequence tag 3SD097F09
Sequence
CCTTTAGTAGTTGGTGTTTTGTCGACAAGAGAAGGCAGAAGAGAGCTGAAAAGGCTTGCTTGCCTTCATGCTAACCTGTA
ACCACAGTGTCAGGCACAGAAGGTGTTTCCGCCTTGATCAACAGTAGGCACATGGGAGGCCTGCTTTCCTTGGGTACATC
CTCGCTTCCTCCAGCACAGGTCTTAAC
Sequence Type genomic DNA
Unitrap ID UNI10335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36089003..36089189 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es