Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D097F05
Clone ID D097F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD097F05
Sequence
GAAAACAATCTCCAAACTGAAGTGGCTCTGAGGTAAATCAGGTGTGATTTTGCATTAGTTTAGAAGATGTGTAAGTGAAA
GGTGACTAATGTCACTATTTCTAAAATATTGTCCTAAACAACTTAGAACATTTTATTTCAGCTCATGAATGGCTGTTCTA
AATCTGTTGTATGTTAGAC
Sequence Type genomic DNA
Unitrap ID UNI30161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37287747..37287925 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]


SPLK-Sequence tag 3SD097F05
Sequence
TCCTTATTTCTCAGGTGTTTGAATTTAAGGATTCTTTAAGGATGGCAAAGGGCTGAAAATGCAGCTCAATAGTAGTGTTT
TCTGGAGGCCCAGGCTTAATCATCAGCCATCCCTACACTTCGCAAATAGGGACTTTCTGAATAACTGTGAGAATGCAAAG
AAAGATAAAT
Sequence Type genomic DNA
Unitrap ID UNI19742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37287480..37287649 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066798 (Zbtb6) NM_146253 zinc finger and BTB domain containing 6 Gene [Source:MGI (curated);Acc:Zbtb6-001]

 
Come back to gene ENSMUSG00000066798


For any suggestions or comments, please send an email to unitrap@crg.es