Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D097E10
Clone ID D097E10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD097E10
Sequence
GGCATTCATAATTTCAGTTTTATAGGTCAGGTATTTAGGATTAGGTTAGTTGGATA
Sequence Type genomic DNA
Unitrap ID UNI22553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105561925..105561980 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]


SPLK-Sequence tag 3SD097E10
Sequence
CACTTCCTTGCATTCTCATTTAATTGTCCTAGGATATTCTCCATGATACTGCTTAGGTGACCCTTGGCATTGCATAGGAT
TTCTCTGAAACGGTGAATGTAAAAAGCA
Sequence Type genomic DNA
Unitrap ID UNI22553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105561678..105561785 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]

 
Come back to gene ENSMUSG00000022119


For any suggestions or comments, please send an email to unitrap@crg.es