Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D096H02
Clone ID D096H02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD096H02
Sequence
GGCCTAGGCTTAGTGGTGGAGCCTTTGCCTAGCACATGTGAAGCCTGCTGTTGTGGAAAACAAGCACCAGAATTATATCC
AAACACCAGAAGAAACGACAAAACACCAGGCAGTTTCCT
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101498308..101498426 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


SPLK-Sequence tag 3SD096H02
Sequence
TTAAATACACCAAAACAAGTGTTGCCCACTGCTTCCCTGTTCTTTGCAGCTCTTTACTCTATATCATCTTCATGCCAC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101497920..101497997 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es