Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D094G08
Clone ID D094G08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD094G08
Sequence
CTGTGGGATGTTGGGGTGCAGTGAATATTATTGGGNNGTTATCCTTGCCTCGTCAGCAAGGCCAGCAGAAAACTCAAGGA
AGGGTGAGGAGATAATCCCCCGTGTCATTCCGTTTTGATTCTGGTCTTGCCTTGGGTGCGGCTGGCCTCTGACAGCCAGT
TCAGTGATTTCCTGGATGGCCTGGGCCCTGCTCAGCTAGTGGGACGCCAGACCCTGGCTACTCCTGCAATGGGTAAGTCT
TTCCGTCACATGACTTCACTGTCCTTTAGATTACTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD094G08
Sequence
TGCTACTTTTAACAGATTACCAGCAAGAATAAAGAGTCCTAGGTTTTAACAGTAAATGTTCTCAGTTTTTTCATTTGTAA
AAATGAAATGATTTCTGATCATCTTCGGACATAAGAATATATCTGGAGAATGTCTGACCCAGAGTTCTTTGGCACAAGCA
TTCTTCCTACATCCTGTTTTTCTTTCCTTTGTGCCCACCAGGTGACATTCAGGTGGGAATGATGGATAAAAAGGGACAGC
TGGAGGTAGAAATCATCCGGGCGCGCGGCCTTGTGGTAAAACCAGGTTCCAAGACACTGCCAGGTAAAACAGAAGAGCGT
CTCTGTTATTCTTATGTCTGTGTCGTTTGGTGTAAATGGTGCCTTTCTTTGCCGAGATCTC
Sequence Type genomic DNA
Unitrap ID UNI30168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39510974..39511352 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es