Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D094D09
Clone ID D094D09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD094D09
Sequence
TGAAATACAATGCAAGGAGGGCTTAGTGGAAGTGCTAGAGCAGATTGTGTGTACACAGCTCTGTGTCTTCCTACTTAGTT
CAGGTCCCCTGCAGACCTTGGGCTGCAGAGCCTCGGTAGCCGAGGGCTTTCCAGGAACGCAGCTGGGGTTGGTGCGTTTG
TTAAAACTTGCAGGAAACAGTTGCCTAGTGCCTGTGGTCACCAGCAGCACTGAGTCATTTCTGCTGCTTTCTCTTCTCCC
AGGGACTTCCTTCCACGAGGATCAGGAATTGTCACCCGGAGGCCTCTCATTCTGCAGCTCATCTTTTCCAAAACAGGTAT
GAGAAATAGAAATTCA
Sequence Type genomic DNA
Unitrap ID UNI909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21261705..21262040 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es