Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D094A11
Clone ID D094A11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD094A11
Sequence
AGTGTTCCTGAGAGAGGTCATGAAGCACGTTTAGATTTAACCAGCGTTGTGTTGAAGTGGCGAGGAGACACAGGNNCAAT
GAGTGGGGCGTGCACAGCGTGNNGAATGAGATCAGCCCTCAGAGGGGAGCCCTTGACCCATCTGTGGTCACAAAACTGTG
GCAGGAGCACCCAAAGAAGGGCAAGGCCAGGACAGAGGAGTGTCTGCATACCCAGAGAGCAGCAGCCAATCCCAGGTGAG
TTAGGAGGAGCCTGAAGGGCTGGGGAGTACCAGGAAGAGAGGT
Sequence Type genomic DNA
Unitrap ID UNI30171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75082152..75082433 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033590 (Myo5c) NM_001081322 myosin VC Gene [Source:MGI Symbol;Acc:MGI:2442485]

 
Come back to gene ENSMUSG00000033590


For any suggestions or comments, please send an email to unitrap@crg.es