Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D093G11
Clone ID D093G11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD093G11
Sequence
TCCATGATCTGTGCCAACCCTTATAAATGAGCAG
Sequence Type genomic DNA
Unitrap ID UNI14281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47785086..47785119 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023984 (Usp49) NM_198421 ubiquitin specific peptidase 49 Gene [Source:MGI (curated);Acc:Usp49-001]

 
Come back to gene ENSMUSG00000023984


For any suggestions or comments, please send an email to unitrap@crg.es