Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D093F07
Clone ID D093F07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD093F07
Sequence
GTGCTCTGTCATTTAAATTTTTGAGATACAGTATTAAAAGATTGTGGAGTTTTAAGTGTAACTAGCAAGTAGCAGTTTCT
TTTGAAAAACAAATAT
Sequence Type genomic DNA
Unitrap ID UNI16012

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27170213..27170308 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es