Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D093C12
Clone ID D093C12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD093C12
Sequence
AGAATACTCACTAGTGAGTAAAGTTGATATTTAGGAGAGTTGATAGCATTCGGGCGCAGCCTGTGACAGGAATGTTGAAG
CAAAGTCGATGTTCTTTGTCTTTGTGTGGAATGCAGGTTTTTGGTGTGGAAAATGTCCCGTTTTGTAGTTTGAAAACATT
AGCTTTATGTTTGCTTTTCTTGTGAGCGATAGGTCAGTAGTGTCAGGGGCCCTGGAGAGATGATGGGGCCTTCTCCCCCC
CTGGCTGTCTAAAATAAACCACCAAAAAGCAAACTACAAGCAGAATCAGCCACATTAAGGGCATGACGTTTAACCTACTT
TGCAGTGAGTTTATATTTATGTGTTTGAGTTGGCAGATTTAGCATATGGGATAGGTCATACCTTCAGCAAAGTTTTTTGT
TTTTTGTTTTGTTTTTTTCCCCTCTTGTTTCCAATCATAAGCAAAAGAAAGACAAATATTTCATGGATGGTGAAAACATT
TA
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129650637..129651118 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]


SPLK-Sequence tag 3SD093C12
Sequence
GATTTCTTTGAAAGAGAAGGTGGAGAAAGCCGTAACCTACATACACAACTACTCTAAGCCCCCAGTGGATGCCTAAGACC
AGACAGTCCCCAGCACCATGAGCACAGTAGGCCCATTGTGACCGTCAGTCTGCTCTATACCACACGTTCAGCTAGTCTCA
GGTAGAAAACAATTGAAAAACATTGCTTTATATTATACACCAAC
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129651416..129651619 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es