Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D093C11
Clone ID D093C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD093C11
Sequence
TGAGCAAGCAGGCTCTTTACCCAGAGTATAGATATTTGGTCAACAGATAGCCTGGAAGTATCTTTTGCTAATTAAGAGAA
ATTCAGGTTT
Sequence Type genomic DNA
Unitrap ID UNI14584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115712212..115712301 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]


SPLK-Sequence tag 3SD093C11
Sequence
CATTTGTNCCTGTATGTGAACAAAGTTTATTCAATTGCTACTGTTATTAACAGGGATGTGGTGAACTTCCTGTTCTCTTT
TATGATGCTGGTAGGATAGAAATCCGACATCATTAAGCTCTACAAAGCAACTTCAGGATATGTAATGGGCTTTTATGATT
GTACTTCATAATCTCGTTTCACTTTGAATATTTGACATACTATATAGACCTTATAAAATAATCTTCAGTACTGTTATGTG
AAATTAGAAAAAAGACATTACTAAATGTATTGGTTATGTTATCCTCACGGCAGGCAATTGGGTAGCCATTAATTGTGCTT
TTGAAGAATAGGTAA
Sequence Type genomic DNA
Unitrap ID UNI14584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115711836..115712171 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041740 (Rnf10) NM_016698 ring finger protein 10 Gene [Source:MGI (curated);Acc:Rnf10-002]

 
Come back to gene ENSMUSG00000041740


For any suggestions or comments, please send an email to unitrap@crg.es