Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D092F01
Clone ID D092F01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD092F01
Sequence
TCTTGTCCTTTCTTGTTGAGATTATTTTATTGCTTTGTCCTATGCAGCTGTTTCTTTCTGGTGGCATCTGTCTGTACAGT
TCTTTGTTTTTTCCCGTTCTCTGGCTGGTTGTCAAAAGTCCTAAGGCAGGAACATTGTAGATGGATTCCTCCCCCATTGT
CTTTTCTCCTGCAGAACCCTGAGCCTGGAGGTTTTCTTTCCCCCCCTCCTCCTGAGGCTTAGTTGATTTGGAGTTGTCAT
GGCAACATTTTTAGCAACTGTGTTGCTCTACAGGAAGCCTTGCTGAATAAAATAAAGAAGCCTTGAACATGATGCACTTG
GGCACTGGTGTTTGTAACAGATGCTGTAAATCTGGACTCTCTCAAATCAAGAGCACCGGCAGCGGAGTAGTATCCAAGAG
CCAACCCTGGGTTTTATGCTTAGTG
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173342582..173343005 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]


SPLK-Sequence tag 3SD092F01
Sequence
TCAGATTTCCTCTTCTTAGATTTGAGGACTGGAATTTGTTTTTTGTTATTCTTATTTGATTTTGAAACAGGACC
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173343032..173343105 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es