Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D092D11
Clone ID D092D11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD092D11
Sequence
AATAGCAAGAACCTATCTCAAACCCACNNAAACCCAAATGTAAATNNGTNGGTAACTTGGTTGATGGCCAATCTGTCCTA
ATCTATCCTTAGGTTATTTAGTTTTTTTATATGCCTCATGTAGTGTGATACTAAATTTCTGTTTGCTAGAAAATATTAAT
GTTTTTAGTGTGGGTTGTTAATCACAGGATATATGTGTCCTCTGTAAGAATCTAGTAACTCCAAACATACTTGGCCCCAG
GGAGCTTATTCTTTGAATAAAGCGTTGGGGCCTGGGACTAAGCTATAGCTCAGTGGGGTGTGGTTACTGCCGGGAAGCCC
TGAGTTCAGTCCTTCGTCTGTCCCACTCCCTTTTCCTGCCAAAGATAGTAGGACTGAGTTTGAGGAGTTGTAGTGATTTC
AGCAAGTACTCTTTGTCCAGCTTAGAAAAGAGCACGTGTCAGTGCTTACTAGGTAAAGTAATCTTCATGGCTCATCACCC
TTCCAGAGGCCGAGAGTTATGGCTAGGGTGTGGCATGCGTTTTTCTGAGAACCTGACACGT
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95169016..95169556 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


SPLK-Sequence tag 3SD092D11
Sequence
TCTAATTTTTAAAAAGCCCGGTTTGAATACCTATTTAGTTTTTAGTATAAATTCCTTTCCAGCAGCACTTATAACATCCA
TGTGGAGAAACTTTGAGGACTGATGGTTAAGAAAATAATTTGTATCTTTTTTTTGGTTAATTTCTT
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95168677..95168822 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es