Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D090F10
Clone ID D090F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD090F10
Sequence
GGTCCAGTCCCTCTGAGAAGCCTCTCCCTTTGCTGCCTTGTCCTAGGCTGTTTGGGGGCCACACTTGGGTCCTTGCTGCA
ACCTTAGGCTTAGAA
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4601509..4601603 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es