Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D090E01
Clone ID D090E01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD090E01
Sequence
GATCCAAGCTTCTATACCAGTGTTTGCATGGTAAGTACTTTATCCACTAAGCCGTCTCTTCAGCCCTCCCCCCTGTTCTA
ATTTGGTGAGGGTGCTGGGGAGAACAAAGTCTCTCTTTGTAGCCCTGGCTAGCCCAACTAAGTATATAGACTATGTCTTA
AAA
Sequence Type genomic DNA
Unitrap ID UNI30178

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45698772..45698933 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006169 (Clint1) NM_001045520 clathrin interactor 1 Gene [Source:MGI (curated);Acc:Clint1-002]


SPLK-Sequence tag 3SD090E01
Sequence
AGATTACTTACTATTAAGTGTGAGTTTGTGCCCTCANNNTCACCACCCTGCACAGACCTGAAATCATAGTGAAATGAAGT
TTTAGGTGAAAAAGCAGAGGAGTGTTTCCTGCTGCGTCACCAGCTTGTGAAGAGCCCTGCTGCCTAATGCCAGCCNNGCC
ATCATTGCTAGGTGCCTCTGACTCAGCATCTAGCATGCCCACTTAGTTAGCATCCCTT
Sequence Type genomic DNA
Unitrap ID UNI30178

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45699247..45699464 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006169 (Clint1) NM_001045520 clathrin interactor 1 Gene [Source:MGI (curated);Acc:Clint1-002]

 
Come back to gene ENSMUSG00000006169


For any suggestions or comments, please send an email to unitrap@crg.es