Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D089E04
Clone ID D089E04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD089E04
Sequence
GATCCGGGCTTTCAGACTCAAGAGTTTCTGGAGGGACAGAGATGTAAGGACCCGAGCTCCTAAAAGTGAAGGAACTAGGG
GGTCCTTAACGGCTGGGAGATCAGCCTTCAAGGGAGAAAAGTTGAAAAGGTTTAGCGATCTGTTCTCTGTTCCCGGAGGA
TTAGGATATATATATTCGGGGGAAGACTTCTNNNCGCTGCCTATTTGGCTTTTGGCATTTAGGCTTTTTCTTGTGTCCGT
TACTTAACCTAGAAAAGCCACATGAAACGTCTTCGTTTTTCTTCATTATTGTGAATCAGATGTGAAGCTGAAAGCAGTTT
GAACTCAGTTATATCCTTGATAAGTACCTT
Sequence Type genomic DNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131830930..131831279 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es