Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D089C02
Clone ID D089C02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD089C02
Sequence
AGAGAAGTTATGTTCTCACAGCATCCCCACTGATGAACCTAATTAATTGTGGGTATTGTGTATGTGATAAAGTGATAGAA
AAAAGTTAGGAATGTGGAGGGGAGAAAGCAAGCGACTTCTGGGTAAGATTGTAAGCTTGGCTCTCCCGGGGCAGGAAACC
TATCTCTGGAGGCTTGGGTTGAGTTGGCTTCCTTCCATTCTGGGCTGGCATGTAAGGAG
Sequence Type genomic DNA
Unitrap ID UNI24170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 35019682..35019901 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032042 (Srpr) NM_026130 signal recognition particle receptor ('docking protein') Gene [Source:MGI (curated);Acc:Srpr-001]

 
Come back to gene ENSMUSG00000032042


For any suggestions or comments, please send an email to unitrap@crg.es