Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D089B12
Clone ID D089B12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD089B12
Sequence
CATGGACTCACATAAATAGTGTAATAAAGCGTCACAGCTAAGTGCCGAGCTGTTTAACATCGTGATGAAGCAGTGTAAGA
AAATTATAGTGGCCACCCCAGTTGATTTAACAGTTCATTATTGGGCTATGATAGTTTGAAAATAGTCTTCTTAGTAGAAA
TAGTGACTGCTTGAATACTGTATTTTCTTGTAT
Sequence Type genomic DNA
Unitrap ID UNI30180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58437919..58438107 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032336 (Nptn) NM_009145 neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

 
Come back to gene ENSMUSG00000032336


For any suggestions or comments, please send an email to unitrap@crg.es