Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D088H03
Clone ID D088H03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD088H03
Sequence
GGGGCTATGCCAGNNNCTGCCTAAGGTGCTCCTGGGATACTTGTAAGGTGTCCCTCTAGTAGCGACACGATGAGCTGTCG
CTGCACCTCCATATCCCGAGCTGTCTGGCCCCACAGTAGCCCAGAAACCAGGCTTCTAAGCACACACTCTGCCAATAGTC
CTCTTCTATCTATGAGTTGGTATCTTACCTTGTACAGATTAAACCTGCCATTTTACATTGAGAATATTGCCCTTGCCTCC
TCCTCCCCGTCCAGCATGGGCGAAGAGTCAGCTCTATGGACTTGTTTAGCCAGGGAAGAAGATTTACTTTTGGGAGGGGG
AGGTTAGGAGAGGTCAAGTTTGTTTCTTGCCCTGAGTGCATGGTGTATGCCAGATAACTGGGAGAGGCTGAGGGAGGGAG
GCTTATGTACAGAGTGGGTGGGGGAGGCTACACTGCCTCTGTCCCTAGCTAAATCAGGGTGTTAATACTTATACTACCAA
GGCTCCAGCTTTACCAGGAGGCTTCTCTTTCCCAGGCTGAGCCTGGGGGGGAGGCTTGGAATGGAGCCCCCCTTCTTTCT
CCTTGGAAAAATAGAGTGCAGTGGCTTAGTAGTTTGGGGGCTTTGTGGGATAGAAGAAATGCTAAGGGCCCTGTCCCCTC
AGGAGGAACTGAGCAGCACAAGCGGGGA
Sequence Type genomic DNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126711127..126711795 637
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

 
Come back to gene ENSMUSG00000025410


For any suggestions or comments, please send an email to unitrap@crg.es