Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D088D02
Clone ID D088D02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD088D02
Sequence
GATCTCCTCACGTGTGCAGGCGGTATATTTTTGTGAGTGGAAGAGTTGCAGGTGTATTAAGTTGCAGGTGTAATCAAGGT
GTAATCCGCCTTAGGGGCTGGATGTCGCCTTCTCTCTAGTTCTGATTTCATGTTGATGGAATGCTCTGTCTGATGTGCTG
TGCCAAGTAACCGCCAGGGGCGCAGCAAGGAGCCGACTGGCTCTGAGGAGGTGTGTAAGGCTGACTAGAAACCCTAGTCC
CTTCTCCTCCTGTTGAGTCAAACGTCCT
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95121333..95121603 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]


SPLK-Sequence tag 3SD088D02
Sequence
GCTGCTTCTCTCTGTGGAATTCAGAACAACAAAGAAGGACCATCAAGCTTGAAGCCCAGTGTGCAGGCCCCCAGCAGTCT
TCACTTCCCAGGGACACAGCGCAAGAATCCCCAGGTTGAGATAGGTGTGCTGTTCTGTGACTACCCAACCCCCACCCTCT
AGCTCCTTACCTTTTTGGTAGGGATAAGCAAGGCACTAGACATTCCTACGCTGCTGGAGCCCGGGAGAGAGGCTCCACCC
ACTCGGGGCCCTTAGCTAGCTCTCTGAATCTTTAACTCTCGAAAGGCTCTATGAAGAAAAACATCCTAGTTATGGGACGG
CTTGGAGATGGCCCAAGGCTAGGGTTGCCTGTGTGCTTGATTTTAGG
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95121623..95121992 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es