Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D088D01
Clone ID D088D01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD088D01
Sequence
GATGTATCAGGAAGCTGTATCTACACTGCAGAGGCAGACAGTGGCTCCCTTTGGTCTGGGGCTGTGGTTTGTGGGCTCTG
TTCTTTCCTACTAAATAATGATACAAGTTAGACCCAGGCTAGGTTGGGGGTGGACTGGCAGGTGGGGGCATTTGACAGGT
ACCCTCCAGTATGCTGCTGAGCCTCACACTCAGGCCCCTGGCTATCTGCTTCTGGTTACAGAGGCTCTCCCAAGCACTTC
TGGGTCCAGGTTTGCACTGCTGGCTTGGGCAGCAGGTATCAGGAGGAAGCTGCTGTCTCAGGTATCCTTGTG
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124479930..124480241 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]


SPLK-Sequence tag 3SD088D01
Sequence
CTATTTTGGGAAGATGAATATGGCAGTGCCTNCCTTCCAGAATGTTGCTCACAGTCATCTTCAGACTTGGGGACTGCCCT
TTACTATCACTTCAGACCTGAGGCCATCATTTTCCATCACAGCCTTTGGATTTAAAAAGCCCAAGGTCTTTTGAACAGGA
ATTGGGTTTCTTTGCTTTAAATAATCCCAGGAAAGGGTTATGTAGTTTCCACCTGTGTTTTCAGGTGTCATTTCTCTCAG
GACAGGCTTACTTAGGCTATTATGTCTCTTAAGCCTTTTATACTTACATAGAAATTGCTGAAGACATGGGCATTCTCTTC
TGCAAACAACCTCAGTGCAGTTATCACACCAGGGGTTTAATATCTGCTGCTTAAACACTAGGGCTTAC
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124480260..124480647 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es