Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D088B07
Clone ID D088B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD088B07
Sequence
TATTCAGTCTTAATGGATAAAATGGTGGGCTTGAATAGTTTTTACTTTTGGGAAAGATAGAATAGTGCTGCCTATAATAA
CTCCTTCTGTATAAGGTCAAGAGTGGTGGCTCTGGGGATCAGT
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32417303..32417425 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SD088B07
Sequence
TGCAGGGACCAACTGCATTGCCTTTCTAGTGCTTATGTCGTAGTGTCAAAACAAAGGAACATTTGATCTTTAGAAGTCCA
AGTCATAGATCAGTATGATAGAAGTGTATAGGCGAAAGTCTGAAAGAAGTAGCCAAAGTT
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32416776..32416915 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es