Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D087E03
Clone ID D087E03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD087E03
Sequence
CACAAGATGACATTACCCCGAAACAAATATACAGTCCTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD087E03
Sequence
TAGGAGAGGCGCCTCCTGTTCCACAGGACTCAGAAGTCCAGTTCATACATAGGCAGTCCCCCCTTGTCAGCCCTCGAGAT
AATCCCCGTGAGCCTTCAGATGGAAGGCTCTAAAGCCTTAACCAGACCTCTGTATGTATCCACATTATAGATCAGAAAGG
GTCTTCACTGCCCTTCCTCCCCTTAAATGTAAACATTCCCCGCCAGTC
Sequence Type genomic DNA
Unitrap ID UNI14694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30142757..30142964 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es