Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D086H03
Clone ID D086H03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD086H03
Sequence
TTAACCATCCACCTACAAACTCAGAGGTGGGCCTTACCCAACTGTAAGCAAATCTTTTACAGGGACTAGAAAGGGCTTGC
TGAGCACTGCCGAGGACCACGTAGTTTTGGGTTGTAGTAGCTTTTCAGTTATTTCATTATTGGCACACTCAACTTCTTGG
CTCTCAGAGGAAGGTGAGTGTTTGGGTACGTCTAGGGCATCTAGGACTTAGGGCCTGTGGAGGACATGGGGAGAAGAAAA
AGTTAAGGCAAAGATGGGTTGAGGTGGCGT
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857191..97857460 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 3SD086H03
Sequence
ACGAAATCAGGGAGAAAGGGAGGAACACTCATGGCTAGAAACTGGCGTTGTGTGTGAGGTTGAGAGAGCATTACTGAGCG
CTGCCTAGAAACCTCAGGTGATCTTGAGGAAGAAACCATGTGAGTCAGGGCAGGGTCATGACTTGGATGGGTTGAGATAA
TTGTTTCTCTGAGAATTCTTTCACCTCAGATATGTTTGTACCTTGATTTGGGCTTCTCAGAAGCCCCCAATCAGTAGCAG
AAGCCTGTGGAAATCCTGTAATAATTCTGGAACGAATATGAGATACACTTCTCTCAGTTTTTATGGTACGGTTGACTGGC
AGTCAGCAACAGTAAGTAGAGGGAAAATTACACTGATAG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857487..97857845 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es