Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D086H02
Clone ID D086H02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD086H02
Sequence
TTTTCCTCCTTAAGGTTTTCATTGCCACGTTATTTTTAAATTGATTTCCCTAAATAAATATATTGTG
Sequence Type genomic DNA
Unitrap ID UNI18689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 77289261..77289327 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071252 (2210408I21Rik) NP_001074822 RIKEN cDNA 2210408I21 gene Gene [Source:MGI Symbol;Acc:MGI:1919621]


SPLK-Sequence tag 3SD086H02
Sequence
AACTTAATGTTAGATGCTCATAAATGCTTCTACTTTGAAAGCATGTTTTTAGTTTTACATTTGTTCCTTGGACTCACCCT
GTGTTTTTGGAGTATGATGGTGCCTGTGTTTATAAATTGGGCTTAAGTTCTCAAAAAGTCATAACCTTTCAAGTCATGGA
GG
Sequence Type genomic DNA
Unitrap ID UNI18689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 77289399..77289561 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071252 (2210408I21Rik) NP_001074822 RIKEN cDNA 2210408I21 gene Gene [Source:MGI Symbol;Acc:MGI:1919621]

 
Come back to gene ENSMUSG00000071252


For any suggestions or comments, please send an email to unitrap@crg.es