Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D086F05
Clone ID D086F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD086F05
Sequence
TATCGTGTGGACTGACAACTTAGGTTGGTTTGAAGGTTCATTTAATAAAGAATTCAAATTTTATGTCAATGATTACTTTT
AAGTTTAAAAAGAATCGCTTTT
Sequence Type genomic DNA
Unitrap ID UNI29961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53643706..53643807 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es