Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D086B06
Clone ID D086B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD086B06
Sequence
GATCTGTAACTGGCCATTTCCCAAGAAACAGCAAGGCCTCTGGGTTTAGAGCCATGGTCTGAAAGCCGCAGATGAACCCT
TAATGTCTCTGGATAAGGCCAGGAATGGGCAACTATGTGTTGTCTTTTGGAGCTCTGAGTCCTGGTTTCTGTGGTTTAGG
CTGAGAAGCAGTTGGCTAGGCAGTCATCTCTTTTGTTNNCCTGTGATGTAGTTCTAATCGTACTAGACAGATCTGATC
Sequence Type genomic DNA
Unitrap ID UNI30187

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52195256..52195493 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es